"Organic" Molecules and Life in the Universe

I have been working on a side-project at NASA trying to create a statistical potential or chemical model that would allow one to distinguish whether a molecule was generated by biotic(living) processes or abiotic(non-living) processes. From my research I have become a somewhat amateur chemist of the universe which has significantly upped my status as a mere chemist of biotic processes(biochemist) on the Pale Blue Dot.

Did you know that amino acids are formed by abiotic processes?

I have always looked at data that meteorites contain amino acids with skepticism, as one should with all Science, especially when it is a little outside the norm or extra-ordinary.

Now that I have learned about it and thought about it, not only is the data solid, the processes make sense and it all starts with the chemical composition of the universe.

The universe is composed primarily of Hydrogen, Oxygen, Carbon, Nitrogen and Helium (yeah the Helium is very interesting! Maybe a blog post on that another time). It is no wonder that organic life on Earth is composed of molecules that contain primarily Hydrogen, Oxygen, Carbon and Nitrogen.

Amino acids are simple molecules composed of these elements

Now if we start to think about what molecules are abundant in the universe we find things like Carbon Monoxide(CO), Methane (CH3) Ammonia (NH3), Hydrogen Cyanide (HCN) and Formaldehyde (H2CO)!

Using mixtures of these Methane, Ammonia and Water Scientists have been able to synthesize some amino acids through applying electrical discharges.

But that's not all, reactions that create amino acids are not uncommon. The reaction of Ammonia with Formaldehyde has a name, The Mannich Reaction

The final product of the Mannich Reaction looks remarkably similar to the Amino Acid, no? It actually is Glycine!

There have been a number of studies to detect interstellar glycine, the simplest amino acid, but so far the results are inconclusive. Scientists think they might have detected it but others want suggest more robust measurements first.

So what does this say about life on Earth and perhaps elsewhere? Was the first "life" an Amino Acid World and not an RNA World? Will other life have an amino acid basis?

There is a paper which suggest that nucleobases can also be found on meteorites though the data is definitely not as robust or the chemistry as simple.

Genetically Engineered Color Changing Flowers, Do they exist?

I am a pretty skeptical person. That is what they taught me during my Ph.D. at UChicago, "Question Everything". That can be good but also bad sometimes (look like a dick for putting down someone's pet project). Anyways, there is company called Revolution Bioengineering that started an Indiegogo campaign up about creating Color Changing Flowers using genetic engineering. Of course I am skeptical. The glowing plant project was supposed to deliver flowers that glow 7 months ago and still there is nothing, yikes!

What I get from their Indiegogo and the answers below is that they are planning to have two products ones that change color once during budding and others that "Change color on Demand"

It just so happens that I met one of the founders at SXSW and asked him if he would do dueling blog posts with me and he agreed. Understand I have never met Nikolai before in my life and this is not preplanned or a publicity stunt. I have not invested in their Indiegogo because I am wary. I gave him this post beforehand so he could write up a response HERE and everyone can see the Scientific basis of the project. If needs be we will then post a second time to allow us both to have rebuttals and ask new questions. In the end we can see if it holds up to scrutiny. I am all about Scientific transparency, if you can claim you can do something you should be able to explain the mechanism of how you plan to do it. I think many of these Science projects people post on Indiegogo or Kickstarter are very vague and lack details. This helps them sell because the public is not usually concerned about that stuff but it makes me wary of over-hype and exaggeration of what is currently possible.



Questions(underlined and bold) and Nikolai/RevBio's Answers(italics)

Color changing is a complicated process, I have worked with engineering bacteria that change color and it takes a long period of time. Visible color change either through chromophores or proteins can take 24 hours and this is usually under special growth conditions such as decreased temperature or optimal nutrient availability. Bacteria are some of the easiest to engineer organisms. Once you take an organism out of a controlled environment or lab how realistic do you think it is to recapitulate the function?

This was something that we considered when we designed this project—Keira and I are two experienced plant synthetic biologists, and it was important for us to do something achievable and not overpromise.  Credibility is a problem in the biotech community.
To that end, we are playing around with the existing anthocyanin pathways—the enzymatic pathways native to petunias that produce the vibrant flower colors.  Petunias are already programmed to produce milliMolar quantities of anthocyanins in flower vacuoles, and we probably can’t do better than that with bioengineering.  (Well, we might be able to with a lot of iterative work, but we don’t have time or money for that right now..)
For the petunia we are crowdfunding to create—the color change on demand—we have an anthocyanin pathway that is broken at a certain early step resulting in a plant with all white flowers.  If we inducibly express the broken enzyme, we get purple/red flowers.
You bring up a very good point about function in real world conditions.  It happens all the time in plant biotechnology that your favorite transgenic works great in a growth chamber, in a laboratory, or in a greenhouse-- but when you take it outside to real world conditions, the trait disappears.  This phenomenon is common knowledge, and part of the reason that the “big guys” do about 6000 unique transformation events, and select the best from that group.  Plant biotechnology is still in the stone age as far as technology goes, and many things are still mysterious enough that it is just a numbers game to get a good plant out of a biotech project.
We don’t have the money or facilities to do 6000 unique transformations, but we will be doing a lot of them and selecting the best responders.

Do you have an exact plan of what you are going to modify and if so can you tell us?

In our color-change-on-demand petunias [anthocyanin 2]AN2 is the broken enzyme.  This is actually not an enzyme in the anthocyanin pathway, but instead a transcriptional activator of that whole pigment pathway.  Without it, the pigment-producing genes are not transcribed.
We are linking expression of AN2 to an ethanol-inducible transcriptional activator.  In our prototype flower, we have AN2 linked to a dexamethasone-inducible transcriptional activator, and that clearly works in a robust way.
https://www.youtube.com/watch?v=hOlO1Cu6E9I
However, we could never distribute a flower that requires dexamethasone to the public.  Or maybe we could, but very few people have Dex laying around their house that they can apply to their flowers, thus the changeover to the ethanol system.
We talk an awful lot about “petunia circadia” and “continuous color change”.  This is a different project, and will be more technically challenging, and is thus listed as a stretch goal on the campaign, not the main goal.
To make Petunia circadia we will be changing the pH within the flower vacuoles.  


I am a little bit confused, will the actual flowers that are growing change color or only new buds about to flower?

Color-change-on-demand : new buds
Petunia circadia : developed flowers
The color-change-on-demand flowers will typically bloom all white.  If you water them with a beer, or spray a flower bud with a beer (we present these beer applications as a possibility, we will need to test the resulting flowers to see what works and what doesn’t) the new flowers will bloom purple.
Once a petunia flower is open, the small molecule building blocks used to make anthocyanins will have been diverted for other uses.  Anthocyanins are also astonishingly stable molecules.  The flowers are locked into being that color, whether they are white or purple.
Petunia flowers last for about 5 days before they senesce, but petunias are prolific bloomers, and will continuously put out new blooms.  So you could change over the entire plant’s flower colors on a one week time scale.  


I assume you are basing your work off of: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1456866/ which seems reasonable but it is not mentioned in the paper how quickly the fading occurs, any idea?

This is for the petunia circadia.  I mentioned that that is a more ambitious project, and there is a lot of testing we would have to do along the path to creating this flower.  That paper you linked to demonstrates the pH change you can achieve through a knockout (roughly 0.5 pH units) and the corresponding color change of the flower.  That pH-color change phenomenon is described several different ways using several different mechanisms by that laboratory.
Circadian promoters form plants are likewise well described and used in synthetic systems (check out luciferase linked to a circadian promoter in arabidopsis here: https://www.youtube.com/watch?v=hOlO1Cu6E9I )
Linking pH change in the vacuole to a circadian promoter will be the challenge.  Will we be doing proton channel expression on a circadian promoter, or doing RNAi knockdowns of a channel on a circadian promoter?  Will the protein lifetime of a proton pump on the plant vacuole exceed the 12 hour timeline of a circadian expression system?  Will we need to stabilize/destabilize proteins/RNAs to get this to work?  There are many unknowns in this project and a lot more testing, measuring, and fiddling required to get petunia circadia to work.  This is definitely higher risk science than color-change on demand, but is still a totally reasonable and doable project.

Do you think any of these engineered processes will affect the normal growth and metabolism properties of the petunias?  

In all cases we will be having a selectable marker in our plants that will be constitutively expressed.  This will place a metabolic burden on the plants that their non-transformed cousins won’t have.  All the clever things we are adding to make the flowers change color will be expressed only using a flower-specific promoter—so metabolic burden will be limited to the reproductive organs, not the photosynthetic tissues.
With all the varieties of plants out there which have been developed with conventional breeding that have one or two genes knocked/overexpressed and still have vigorous growth habits, I don’t think it won’t be too hard to get a robustly-growing petunia out of this. 




If you have questions feel free to post them and I will send them to Nikolai next time around

Posers in DIY Science and Hacker Movements

A problem I have been failing to overlook lately is the number of posers in DIY Science.

A lot of times I relate DIY science to the computer hacker movement in the 90s because I feel there are many similarities. However, one of the big difference I see is that the DIY community is a lot more accepting of posers and people that detract from the community. I can't tell if it is because people don't know better or that DIY Science attracts much more timid personalities than hacking did and so very few people call others out on their bullshit.

With hackers there was a hierarchy mostly based on skill and knowledge. To move up this hierarchy one needed to face the gauntlet of criticisms and challenges to your skill and knowledge. This was done through code output, chat and submissions to 'zines. Honestly, it sounds a lot like graduate school. I will admit that this is a harsh type of culture, to be constantly challenged but it creates a culture based alot on honesty, logic and truth. 

When I first became involved with other DIY Science people, the lack of knowledge stunned me. I thought I could help by pointing out why people's ideas would not work and what knowledge gaps they needed to fill. This is what happened in the computer hacker movement and also graduate school. It seems to be a model that works well. It just requires people to be over their own egos. This received much backlash in the community, much more than I expected and I still haven't quite figured out why? I began to stop myself from calling out every person when they posted something wrong or had a really bad idea. I figured that they probably are not having that much of an effect on the community as a whole. I think this is untrue though and it just makes it more acceptable for other people to propagate bad ideas and information. I just can't be the asshole who stops them. Also, I do understand that sometimes people make mistakes. I mean I know I have had some bad ideas in my life and I still do. However, it is becoming harder and harder for me to keep quiet because there are so many people in DIY that are placed in positions of responsibility or influence and have no knowledge or skill to offer. Even sometimes in fact offering wrong information, misinformation and pseudo-science. This lack of self policing in the DIY community, I imagine, has contributed alot to its growing pains . As far as I know no significant work has yet to come out of DIY Science. As the arrogant person I am, I would cite some of my own work like The Chromochord, but this is still niche. That fact that there is no significant work is a problem. 

Personally I think the main problems are education and access to resources. Despite bitching at posers I actually try to contribute by teaching classes at Biocurious and providing inexpensive Science supplies at The ODIN but it seems I don't have enough time to contribute to make a significant in a dent in these issues. 

I don't know how the hacker movement harnessed such a small subculture of auto-didacts who taught themselves by reading RFCs and manuals and learned programming from books. Replication of this feat in my lifetime would be impressive.

So, how does one help DIY Science? Despite all the clamor over online courses I don't believe that they work well. From personal experience, taking the courses and attempting to learn on my own, I have never gained as much as from a real world class. In fact not even close. I feel this is because it is hard to dedicate the time and energy to an online class that one normally would to a real world class. This doesn't mean that there are not people that benefit from these classes but it doesn't bode well when an educated auto-didact doesn't prosper from online classes (though I know I am a little weird). This is besides the fact that most Science experimentation requires a hands-on component. Science is really like a sport there are things people can teach you but it also requires actual doing to become successful. To me this is why [graduate] school is so important for Science! It's like trying to teach someone creativity, you can't, it is something that people develop through experience. 

So finally, how do we rid DIY Science of the posers like the computer hackers did? Maybe it  worked out because hacking started with mostly educated people who had access to computers and thus the hierarchy was born in from the beginning. Maybe for DIY Science, first, there needs to be a shift in balance where people with actual knowledge and skills are established as the majority. At the moment it seems the number of posers far outweigh everyone else and this is a huugggeee problem because the movement will not be able to grow well without knowledgeable teachers. In the end, despite what happened in the computer hacker movement, you are not the starring performer in Good Will Hunting. To change DIY Science is going to take a lot of grinding.

Why Lab Automation is NOT the Future of Science but Networking and Remote Access IS

So PCR is one of the most simple and basic molecular biology experiments to do.

Let's try and envision what an automated PCR system would entail...

1. Every primer, template, enzyme and buffer would need to be stored and labelled in such a way that a robot could access them. This is difficult given that most of these should and need to be stored in at least -20C for long-term storage. So we need a robot accessible freezer system with each individual tube barcoded or placed in a known spot. This is extremely cost and space prohibitive. Also, creating the database of every component would take effort.

2. You need a robot that can pipette and move liquids that are not frozen so you need it outside of the freezer storage system.

3. You need a robot to move the tubes into the PCR machine or some setup where the PCR machine is integrated into #2.

4. You need someone to tell the robot what primers, DNA, enzyme, buffers and PCR protocol to use.

After you spend probably $5 million+ for this system. It would still take someone probably the same amount of time to use the program to setup the robots that it would take someone to setup 8 PCR reactions, that is, less than 5 minutes. In the long run it would probably take much much more time in maintenance and troubleshooting issues with the robot hardware and software.

The majority of researchers in the majority of labs perform probably around 8 or less PCR reactions per experiment. This is important because Lab Automation will only succeed when time and monetary investment is less than the time and monetary investment of doing it manually and currently it is a far way off.

For millions of dollars in investment one expects a couple orders of magnitude in time saved. This system would not even help if it is scaled up by say, doing 96 PCR reactions. If each reaction uses an individual template or primers at about 20 seconds per manual primer addition per well(everything else can be done in about 2 minutes with a multichannel pipette and mastermix) you are looking at about 32 minutes. To manual enter the names of each individual primer into a program for 96 different wells would take at best 5-10 seconds per primer. So even for 96 well plates one is only saving researchers half their time and again this doesn't include troubleshooting if say the robot has trouble removing a tube because condensation built-up and froze on the storage box. If someone used a robot everyday and saved themselves 15 minutes at the end of the year they would have saved themselves 91 hours for millions of dollars. How many hours a year are worth $5 million? The average Science researcher(grad students and post docs) probably work >2,000 hours a year and are paid around < $45k. For $5 million, one could hire ~111 people to do work for a year and there is no service contract required for people, they are pretty robust and don't break down very often.

The idea that everything can be automated is not true and especially not true for Science and probably will not be for a long time. There are very niche uses for automation robots in Science but these are very unique circumstances and not an everyday type of thing.

People who think lab automation is the Future of Science have not spent much time in a lab.In fact I have yet to meet someone who has spent alot of time in a lab who believes automation will help Science. I am sure there are people out there but it is definitely a minority.

So what does Science need then?

Science really needs Remote Access and Remote Control. Say on my way to work in the morning I figure I need turn on a couple of incubators or change the temperature in some because I had a culture expressing proteins. Maybe I wanted to equilibrate my H(F)PLC column? What if I could do this from my cell phone? The thing that needs to be optimized in Science is not the "work time" it is the "down time". When I need to wait 30 minutes for my H(F)PLC column to equilibrate and cannot use it or when I need to wait for a centrifuge to cool down or an incubator to heat up or many of the other things. This is where time is wasted. Transferring data files between computers or restarting a experiment on a piece of hardware remotely this would drastically help Scientific productivity.

Networking labs and providing things like remote access costs a fraction of automation. We are talking in the $10ks to $100ks per lab.

I really tried to have this instituted at our NMR facility at UChicago because I had to head down to the NMR room, about a 5 minute walk, anytime I wanted to start an experiment or access data, a computer not connected to the outside internet was the interface to the Spectrometer. I would have saved myself hours of down time because I could have spent 5 minutes using remote access to start another experiment from home or restart an experiment with a different parameter, time wasted because I wasn't on campus or was far enough away that it impeded me going to the NMR room at the moment.

Labs are for sure still stuck in the 1970s but not in an automation sort of way, in an access sort of way.

It's 2015, I work at NASA(we are supposed to be high tech(yeah right I know NASA is still stuck in the 1970s)) and I can't even access the computer that was purchased brand new last year that is in the other room without walking there and sitting at the console. That is a problem...

I even started to work on this problem a little bit by making Arduinos controllable through a webpage so they could switch relays or run equipment (http://doitourselfscience.blogspot.com/2014/03/sending-and-receiving-data-from-arduino.html). After the basic setup though I figured I would rather spend time doing research then building such as system. Foo on me.

Engineering Skin Bateria

I think that the future of wearable technology is engineered bacteria.

So I started working with skin bacteria for a project. I am trying to see how well skin bacteria can be engineered and used to colonize the skin and perform the process that they were engineered to do. The processes I want them to do at the moment are very basic, express fluorescent proteins or use luciferase to glow. This project then a little more difficult than I expected. 

What I did not know is that many of the bacteria on our skin are antibiotic resistant. A little scary? Actually not that scary as it seems a natural step in our symbiotic evolution. So why is this important then? When engineering bacteria scientist often use selection markers and most of the time these are antibiotics. This is because genetic engineering is not quite as efficient as you would hope it to be and also because finding the bacteria that have been engineered can be a difficult process if one is searching through a thousand different bacterial colonies. Antibiotics are great because they kill off all the bacteria that have not been engineered and you are usually left with the ones that have been engineered! But that's not always the case as I'm seeing now. 

First, I started off isolating bacteria from my skin by taking swabs and streaking the swabs on plates and then growing them at different temperatures. Next, I chose some bacteria and grew them up and put them in a solution that would make them more tenable to uptake foreign DNA (The DNA I wanted to put inside them). What I found was that the antibiotics that I was using for selection were not working. So then I started again. 

First I had to test each bacteria isolated from my skin and see if the antibiotics that I was using for engineering selection actually kill the bacterium.

Even after I found a bacterium that was not resistant to the antibiotic I was using (Ampicillin) I found out it was still resistant to other antibiotics (Kanamycin). You can see in the image above that bacteria #2 and #3 both survive on ampicillin fine. I ended up finding out the #1 also doesn't mind ampicillin much when doing liquid cultures so I have been working with #4.

Currently, I am using bacteria #4 and trying to put plasmid DNA inside of them. Once I can tell that this works and the bacteria grow and function on media I will test the bacteria to see if they can grow at all on my skin. The test after that will involve seeing if the bacteria actually colonize my skin so that even after washing the affected area there will still be some bacteria left. 

I think this will be the most difficult problem. 

As many scientists suggest engineered bacteria that are creating proteins or products that are not meant for survival are at a disadvantage when fighting for a spot on your skin amongst all the other bacteria. However, there are many ways to overcome this including giving the bacteria some sort of selective advantage by altering its metabolism to be more robust than naturally occurring bacteria. 

I am about to sequence the DNA of bacteria #4. By the looks of it I would say it is either a Streptococcus or a Enterococcus (This is an attempt to impress myself with my weak bacterial knowledge). As my work has made me quite the amateur microbiologist lately being able to identify by colony morphology and color pretty well.

I will keep updating as this experiment progresses.

Originally this idea was bounced around by myself and Jun Axup, though I am sure it is probably not original and has been tried by others. My goal is just to test some proof of concept ideas.

The Open Discovery Institute (ODIN)

Most of my Non-DIY Science friends don’t know this about me but about a year ago I started an online store that sells molecular biology supplies to anyone who wants to buy them. I also sell them at very inexpensive prices because I buy them in bulk from manufacturers or other suppliers. It is called The Open Discovery Institute (ODIN). I don’t remember how exactly that name took shape, all I remember is that James Crooks and I were thinking of starting a Hackerspace on the South-Side of Chicago (Which we eventually did not but he eventually did!). I really believe in the strength of the masses. I think that people with access to Science supplies and equipment should be able to do Science well. For me it all starts with access.

During graduate school I would sometimes do experiments at home and when I wanted to buy supplies there was no place I could go to find all the things I needed at reasonable prices. It would take me hours just to find a good price for two chemicals and then there was multiple shipping costs and such. When I arrived at NASA and had a little extra money I figured I would invest in people. A single person doesn't have much power. A single person can die, disappear, give up. Many people can contribute to something and do something much greater than what a single person can do. 

One of my favorite hypotheticals is "What if the population of Scientists in the world doubled or tripled?" It would be exciting, it would speed the rates of discoveries! Life would be prolonged from a better understanding of diseases and more discoveries could be made and we would have a little extra time to see and create beautiful things.

I invested in The ODIN as an experiment for me, 1) To see what kind of demand there was out there for providing these supplies to DIY Science peeps, & 2) To see what it is like to run a business.

What I have figured out is that I really suck at running a business. At least a business where I am the sole employee. I am great at inspiring people and motivating people and I have alot of knowledge and skills to share. I just am awful at the businessy things. I mess up orders, I give away lots of free stuff. I don’t charge as much as I should. I don’t keep track of the finances.

That's the bad or I guess maybe it is good I learned that.

However, the most positive thing about The ODIN is that people actually need this service. I have sold and shipped ~50 orders over the past 10ish months to the US, Russia, Canada, Taiwan, France, Netherlands, & many others. People are actually doing Science in their homes, at Hackerspaces, in High Schools.That is pretty exciting. 

The reason I never told most people I know about The ODIN was because it was an experiment. I wanted to see who would use it organically. I have told people on DIY Bio mailing lists and people who use Biocurious, the Silicon Valley Biohackerspace and have had a number of repeat customers. 

I want to tell people about it now because the experiment was a success. Many academics I know think that people outside of labs don't want to do Science or have no way to contribute. It is untrue. There are people who have a passion for Science who were not formally trained who are actually attempting to contribute. 

I think it is pretty obvious now that with such easy and inexpensive access to knowledge people are using it to do things on their own. They might be called “Makers” or “DIYers” or even “Citizen Scientists” but whoever they are, cool shit is being built and created.

Create Something Beautiful.

Building a Genome from a Picture aka The Scanning Room

Time to explain my piece that is at ZKM

So you want to know what is in your genome, maybe like me, you spent 20 minutes spitting into a tube and sent it off to a company like 23andMe and have your genome arrayed for Single Nucleotide Polymorphisms (SNP but never snip. I tend to not pronounce acronyms unless they are phonetic otherwise it prevents people from looking them up on the internet). What 23andMe does is match these SNPs to studies that have been performed that associate the DNA sequence to a specific phenotype in a human being. They tell you that you are caucasian and have a probability of having wet earwax and blue hair.

I had an idea, what if we could create a noninvasive way to composite and predict a genome, like predicting a protein sequence by its structure. What if we could take phenotypic features from a picture of someone and composite a genome? What if just from a picture of someone you could tell if they had a gene associated with a specific disease or disease risk? Did you know that some genes(alleles) occur in greater than 90% of people with certain phenotypic traits?


This project is speculative. Our current understanding of our genomes only allows major traits to be distinguished. No one has studied things such as the association of chin to lip length on genes that are associated with bad teeth. This will happen though. Eventually our understanding of our genomes will allow one to learn alot about a person from only a picture. Data Science in this area is very primitive at the moment. With most genomes studied there are not pictures associated with them or much else.

From what I can tell no one has publicly(looking at you governments) tried to determine genetics from a photo. To me this project was an interesting idea to see how invasive one could be with just a picture. To maybe look a little bit at what the future holds. What if instead of giving a company your love interests DNA to sequence, like in GATTICA, you just upload a picture to a webserver?



This was the idea and this is the piece.

How it works:

It starts with a picture.

I wrote all the code in C++, which I consider an awful programming language. The program is multithreaded and uses the OpenCV library. It uses a webcam to try and find a human face in the streaming video it is constantly taking. Then comes the machine learning, I used a number of different machine learning algorithms that are built into the OpenCV API and ran them on a database of somewhere between 500-1000 faces that were sorted by sex and ancestry(race). Combining the different algorithms I performed "boosting" to create a meta-algorithm of sorts, which really helped (I have not statistically quantified by how much though). Because I wanted my training set to be reliable I needed a way to build this database of training images as I could not find a dataset like this that existed and the NSA wouldn't answer my emails. I ended up scraping OkCupid and using people's self-identified race and sex to build my training dataset. I also hand-curated these images.

Side Note:
If you ever post a picture on a dating website please look forward and directly at the camera with no sunglasses or hat on because that might make the day of a data scientist. Seriously, I had a program that did face and eye detection and cropped the photos and only about 20%-30% were usable!

The interesting thing is that machines see more than you or I. We as humans are limited usually, to what we have been trained to look for. Machine learning allows computers to explore associations that humans cannot perform. With decent lighting the sex and race detection are actually pretty good!

Sadly, since my datasets are pretty big and using different algorithms for comparison on a semi-old laptop it takes about 20 seconds for the detection to run. I needed a faster method otherwise people who interacted with it would become bored. I found servers online that provide APIs to do the same thing but I needed to sacrifice the freedom to have any of the races I wanted and to create an expanding dataset. Sucks, but it runs in about 2 seconds instead of 20. And it is also good that I have both a version that can run without the internet(original version) and the one with the online API.

Next, the program starts breaking down different features of the face, eye color, hair color, skin color. Color is an interesting thing. On computers the way we define them most frequently is through Red Green Blue(RGB) values. But really what is Red? RGB: 255 0 0? Of course! RGB: 255 100 100? Maybe??? RGB: 255 255 255? Definitely not. even genetic studies reference "blue" eyes, "brown" hair when their blue could include blue green and their brown could also be blackish. So when I was going to associate an SNP with blue eyes, I first needed to figure out what RGB values I thought blue was. That was interesting. I kind of just typed in values and created cut-offs based on what I saw, so pretty arbitrary...

Then I built my database of alleles, that were associated with traits such as race, sex, skin color, &c.

The program also talks to you and shows you videos and your genes.

So from the start:

You walk in and see a large display on the wall with a live feed. It detects your face, it uses machine learning to identify traits about you and tells you about your genome, showing you DNA sequences of the alleles you are predicted to have based on these traits. While it is doing this the program is talking to you generatively by using Google Translate English to English as a text-to-speech engine(little trick I picked up that works GREAT!).

Code for the version using the Online API
https://drive.google.com/folderview?id=0B_R75gIJvkFUczBxNXk3ZGtWRDg&usp=sharing


A bunch of face images cropped, aligned and sorted by self-identified sex (male. female) and self-identified race (caucasian, black, asian)
https://drive.google.com/folderview?id=0B_R75gIJvkFUdVAxNE45NXhSXzA&usp=sharing

 

This video plays when your presence is 

detected in the Scanning Room by the software

What is Art and Science

Lately I have been making the claim that technology revolutions cause changes in culture and those changes are usually integrated into our Art. This is evidenced by Digital Art, Robotic Art and others. Science and Biotechnology are becoming more integrated with our culture and with it brings Science.Art. Sadly, many scientist.artists create pieces that are neither Science or Art. Maybe it is a bit egotistical but I feel a bit shamed to be placed in the same category as these people. The thing is that I never wanted to be placed in the category of Artist. It is not till now when people want to curate my works in museums that I really need to ask myself "Am I an Artist?"

As Kanye said "I ask cause I'm not sure, does anyone make real shit anymore?". Many Science.Art pieces lack either a Scientific part or an Artistic part and to me end up being something that is difficult to appreciate. I often see artists claiming Science but their works are very missleading and are not actually what they say they are or believe them to be. And Scienctists claiming Art when their works are neither. I will give a few as reference.

Christina Agapakis puts bacteria on plates mostly (http://agapakis.com/art.html). This is really not Science. As for it's Artistic merit some could argue for it but this kind of work has been done many many times before in slightly different contexts ala Steve Kurtz and many others. The depth and skill seems lacking and way behind on the times. Maybe it's interesting and speculative nature would have been there 10 or 20 years ago but not now, not like this.

Jalila Essaidi told the world she made "bullet-proof skin". What I thought and imagined was that she trangenically expressed proteins in epidermal cells that allowed them to be bullet-proof. I was interested and I emailed her. What she actually did was take a bullet-proof material and then put human(mammalian?) cells on it and call it skin. (http://jalilaessaidi.com/). She didn't respond to my second email when I asked her the specifics of how the project was done and why she thought it was skin.

Ginger Dosier claims she is an Architect and Scientist. From what it appears, she uses Scientific work others have done and claims it as her own (http://vergelabs.com/). I tried to contact her about her work but she did not respond. It seems the people she impresses don't know enough about biocementation and bioclogging to know better. That is a field I have been starting to work in at NASA. Using engineered bacteria and proteins to harden soils and regoliths. (If you read this Ginger and have performed some new work in biocementation please contact me and let me know what it is. I am sure Scientists would appreciate knowing your advances) 

There are many many more but you get the picture. Maybe people see this as hating, I see it as having a high standard. Having respect for the quality of the work one puts out.


What is Art? People always say that this is a difficult question to answer but I have never thought so. I think that people can argue Artistic Merit of certain works but I think what makes something Art is that it is done by an Artist. Just as Science is done by a Scientist. So who is an Artist? If anything can be Art then what is the need for Artists? Why can't we all just stick petri plates on a wall and be done with it? An Artist to me is someone who is trained and.or dedicated to their craft. Someone who can create works that require "skill" and I think that is the word that differentiates Artists from non-Artists, skill. This is what differentiates a Scientist, a Footballer, a Medical Doctor from everyone else, skill. Skill can be somewhat quantified. If someone claiming to be a Scientist doesn't know Science then they are not. If someone claiming to be an Artist has never been dedicated to the craft then they are not.

I often refrain from calling myself an Artist directly. My work is mostly Science and Engineering with about 10% Art. Lately it has started to travel into the realm of speculative Science and Engineering and that is where the 10% Art comes in.  I think this speculative  but functional nature of some of my works, such as The Chromochord, (What would a future be like when organics are components in electrically engineered projects?) can perhaps be viewed as Artistic. Both the Science and the Art are original.

Look at works of Artists I know, Micah Zayner (https://www.facebook.com/micahjzayner) and Zachary Williams (https://www.facebook.com/pages/Zachary-J-Williams/284392201665097). Their craft is skilled, well thought out and has depth. Just because you go out with your friends and pay $30 to drink wine and paint pictures doesn't make you an Artist or your work a piece of Art. It is some oil or acrylic based colors dried on some material. Art takes dedication and skill.

Scientists can tell the difference between Science and science. Science takes skill, is well thought out and has depth, science does not.


For me Science.Art and Technology.Art require that the Artist add something original to both Science and Art. Maybe these are very stringent requirements and it takes dedication and skill to create a piece of that nature. To me

THAT IS THE POINT OF ART!

Stochastic Labs and The Infinity Engine

I haven't talked much about The Infinity Engine or my residency and grant from Stochastic Labs. In July of 2014 I heard about this mysterious organization known as "Stochastic Labs" that had no website or information about what it was there was just a form to fill out for a grant for ~$20,000. I posted my application on my blog (http://doitourselfscience.blogspot.com/2014/07/stochastic-labs-application.html). They contacted and said that they wanted to fund me, but not me alone, they wanted me to work with someone else and they had this person in mind and her name was Lynn Hershman the director of Strange Culture. Lynn was interested in doing some works around genetic engineering and so was I. I was pretty skeptical at first because I didn't think someone who works in media would have a good idea of how to work on Science projects but I agreed anyway, I mean they were giving me $10k.

I found out Stochastic Labs was in a mansion in Berkeley and it is a nice mansion. Stochastic Labs is funded by The Minerva Foundation. The residency started on August 15th and ended on October 15th. It was short but it was pretty intense. We had dinners there every Monday and gatherings on random days. Alot of cool and interesting people were invited to the Monday dinners. The funny part was I never knew who they were. I would be talking to someone and find out they were an Actor or a Nobel Prize winner or director of a movie I saw.

I would head up to Berkeley after work at NASA and would stay till traffic abated or I ran out of Red Bull around 9 or 10PM and give fellow grantee Greg Leppert a ride home.

Anyways, I had lots of fun up there and worked hard to create a program or "device" I guess which takes a picture of someone and attempts to probabilistically reverse engineer their genome from their physical traits. It also talks to you and tells you what it is doing and what it found. The current iteration is pretty basic it uses facial features to identify ancestry, sex, skin color, eye color, hair color, &c. and maps those to the genes that have been identified to be associated with those traits. Eventually I want it to construct pseudo genomes using an ancestry base genome and editing in traits it identifies from each person it captures.

This will be part of an installation that will be on display starting at ZKM in Karlsruhe Germany on Dec. 12th to the end of March and then will visit other places in the world.

Science Hack Day SF 2014: DIY DNA Sequencing

Science Hack Day San Francisco was this past weekend(Oct. 4th and 5th) and it was a good time. Much better than the Y combinator hackathon I went to a few months ago. The great thing was that most everyone was there to have fun. There wasn't really any competitive spirit and people didn't limit themselves to ideas that were pitches (though it is SF so there were a few of those).

Github HQ is pretty damn nice. Besides the air conditioner being broken it would be great to have it there again.

My hackathon idea was pretty ambitious. The goal was to create a method and protocol for inexpensive, DIY, Sanger DNA sequencing. The goal was _not_ to be able to sequence a whole gene but perhaps just 10-20 basepairs. This would be enough to accurately identify if the DNA you have is your gene of interest.

The problem with normal Sanger sequencing is that it either uses really expensive equipment or uses toxic components, i.e. radioactive primers or nucleobases and acrylamide. What if it was possible to do it without these things?

The goal was to be able to do DNA sequencing with a PCR machine and an agarose gel electrophoresis setup.

Sounds crazy, I know. Sounds very ambitious, I know. But the one thing I have learned over and over again in my life is that if you want to push our boundaries of understanding what is possible one needs to try something crazy and ambitious.

So first the results for people who don't really care about the protocol. I/We were having trouble having the sequencing reactions work so we ended up just attempting to separate two primers that differed by only one base pair. The ability of Sanger sequencing to work depends on if one can separate DNA fragments with base pair resolution.

T7 fwd primer -20 bases
TAATACGACTCACTATAGGG
T7 Terminator - 19 bases
GCTAGTTATTGCTCAGCGG

What one can see in the image in the middle lane is the T7 fwd primer with a fluorescein label and the T7 terminator primer stained with gel green on a 10% agarose gel. The reason I wrote 20.5 instead of 20 is that the fluorescein molecule adds about 0.5-1 base. Still it is amazing resolution. To our knowledge this has never been done before, 1-2 base separation in an agarose gel (imaging was done with a $2 setup, some LEDs and a plastic filter).

I plan to continue this project and successfully run a sequencing reaction to show that not only can we separate with proper resolution we can also sequence.

Information about the experiment is here:
https://docs.google.com/document/d/1d3O254Akps58kaRMoGHL3j47X3bQylEJ2Flbv8UixLc/edit?usp=sharing

A bunch of people helped out:
Nelson Cheung
Cristina Deptula
Petr Glotov
Tito Jankowski
Tim Looney
Michael McCanna(Acrefoot)
Cheryl O'Rourke
Chris Ragsdale
Janelle Ruiz

Motive

I was at the grocery store this morning and saw a child wearing an outfit with wings and I began to contemplate why it was completely acceptable but for an adult it is not really (well at least any place but SF and burning man).

I came to the conclusions that maybe it was motive. A child wearing wings doesn't really have a motive besides to enjoy themselves. An adult when they are wearing wings would have a hard time convincing you that they don't have a motive. Many adults have reached the intellectual place where they can reason about what they wear. This means that choosing what they wear probably involved weighing the consequences and benefits of each outfit. Eventually they can come to the conclusion of "Why the fuck not?" but that is not common as society has shown that people rarely engage in things that are outside of "norm". Probably because we have egos.

Motive comes across pretty well in humans. I was watching videos by tom nestor and my uncle, robb thompson, yesterday (ex. https://www.youtube.com/watch?v=L59a1JPJgWE) . It is obvious in that video that tom is trying to sell you something. His motives immediately seem disingenuous, with the title being "how to quadruple your income"(Why isn't he quadrupling his income? And if he is everyday he should have all the money in the world pretty soon!). Watch his facial expressions, it is obvious he is acting. Motive comes across in your speech especially when giving public talks.

I think this is important as a Scientist or Teacher. People can tell your motives. I used to be really nervous before speaking and sometimes still have a little nerves. It is usually when my motives are different from how I truly feel. Then I have fear of being found out. Most people give talks because they want to impress people. Sure, you can build up a huge ego and that helps overcome the fear of public speaking but so does having a true motive.

Now when I give talks. I give them to tell people about things I am excited and passionate about. Things I enjoy and love. It is hard to be nervous then. People usually want to share in that passion and love. Very very few people responded negatively to love and passion in that situation.

I think about my motives alot. Why do I have blue hair and piercings? Is it because I want them or because I want to portray things to other people? I think it is because that is how I see myself but why do I see myself that way? Maybe I just want to be punk. I think this self-evaluation is always a good thing. It helps me to have genuine motives. Though let's be honest I am not always genuine. But at least I don't look and act like someone such as tom nestor.

Does Hard Work Stifle Innovation?

So yesterday I was at a cookout(which is different from a barbeque in case you did not know) at Stochastic Labs(more about Stochastic Labs soon) and I was tasked with making some fresh squeezed lemon juice for an alcoholic drink. After a few attempts to find or develop a work free method I gave up and just started "hand squeezing" the lemons by using the bottom of a glass as a pommel to press the lemon juice out.

This started an interesting conversation. If labor is free or when it has been inexpensive during times of slavery, did this stifle innovation? It would stem from the "Why develop something new when inexpensive labor will always be plentiful?"

Then this started me thinking about my own life and graduate school and academic Science and Science in general. Does working hard actually lead to more innovation? To the development of new and better things or creative solutions to problems? What if working too hard actually inhibits this process?

It seems to me that there is a point when the pressure to produce something overwhelms the pressure to actually accomplish something interesting or cool or productive. I know during graduate school I worked my ass off and did accomplish some stuff but none of my Scientific body of work would I describe as interesting or cool or innovative. The goals of Science are very insubstantial. Everything is based on the perceived impact of other Scientists and has little to do with the actual outcome of the work.

When is the last time you talked to someone about all of your crazy ideas and they didn't judge you from the outset?

Last night I was chilling at Stochastic Labs and talking with a bunch of well known Scientists and Artists, including Nobel Prize winner Saul Perlmutter who is pretty fucking cool. I never would have guessed. Anyways, the ideas and conversations were interesting and varied but I have never experienced conversations like that in an academic environment. There was no pressure, people's crazy ideas and thoughts were constantly being put out there. Including mine, haha.

I think that graduate school really inhibits genius. The goal in graduate school is not to be a genius. It is to work hard and accomplish something. Maybe that is the problem. Pressure to be viewed successful in the eyes of your peers and mentors anddirect pressure from your peers and mentors does not allow one to actively develop new ideas and try out new avenues of experimentation. Instead of figuring out better methods than a western blot people run hundreds of them. Instead of learning to program you manual input all the data.

If schools truly want to train genuises they need to do that instead of forcing graduate students and post docs to be cheap labor for someone who probably acquired a job as a professor based mostly on good fortune and nepotism.

"I want you to work on your idea." should be a more frequently used phrase in graduate school.
"I want you to take your time." should be said more often.

At least in my life I have learned that a good Scientist.Artist.Technologist needs time to think. Whether it is going for a walk or run or driving around. Maybe it is just sitting and relaxing and thinking. Working isn't the best way to solve a problem, it is thinking and then working.

So I wonder if it is true. Does long work hours and pressure inhibit innovation? Are the best Scientists and graduate students the ones with ample free time?