Building a Genome from a Picture aka The Scanning Room

Time to explain my piece that is at ZKM

So you want to know what is in your genome, maybe like me, you spent 20 minutes spitting into a tube and sent it off to a company like 23andMe and have your genome arrayed for Single Nucleotide Polymorphisms (SNP but never snip. I tend to not pronounce acronyms unless they are phonetic otherwise it prevents people from looking them up on the internet). What 23andMe does is match these SNPs to studies that have been performed that associate the DNA sequence to a specific phenotype in a human being. They tell you that you are caucasian and have a probability of having wet earwax and blue hair.

I had an idea, what if we could create a noninvasive way to composite and predict a genome, like predicting a protein sequence by its structure. What if we could take phenotypic features from a picture of someone and composite a genome? What if just from a picture of someone you could tell if they had a gene associated with a specific disease or disease risk? Did you know that some genes(alleles) occur in greater than 90% of people with certain phenotypic traits?


This project is speculative. Our current understanding of our genomes only allows major traits to be distinguished. No one has studied things such as the association of chin to lip length on genes that are associated with bad teeth. This will happen though. Eventually our understanding of our genomes will allow one to learn alot about a person from only a picture. Data Science in this area is very primitive at the moment. With most genomes studied there are not pictures associated with them or much else.

From what I can tell no one has publicly(looking at you governments) tried to determine genetics from a photo. To me this project was an interesting idea to see how invasive one could be with just a picture. To maybe look a little bit at what the future holds. What if instead of giving a company your love interests DNA to sequence, like in GATTICA, you just upload a picture to a webserver?



This was the idea and this is the piece.

How it works:

It starts with a picture.

I wrote all the code in C++, which I consider an awful programming language. The program is multithreaded and uses the OpenCV library. It uses a webcam to try and find a human face in the streaming video it is constantly taking. Then comes the machine learning, I used a number of different machine learning algorithms that are built into the OpenCV API and ran them on a database of somewhere between 500-1000 faces that were sorted by sex and ancestry(race). Combining the different algorithms I performed "boosting" to create a meta-algorithm of sorts, which really helped (I have not statistically quantified by how much though). Because I wanted my training set to be reliable I needed a way to build this database of training images as I could not find a dataset like this that existed and the NSA wouldn't answer my emails. I ended up scraping OkCupid and using people's self-identified race and sex to build my training dataset. I also hand-curated these images.

Side Note:
If you ever post a picture on a dating website please look forward and directly at the camera with no sunglasses or hat on because that might make the day of a data scientist. Seriously, I had a program that did face and eye detection and cropped the photos and only about 20%-30% were usable!

The interesting thing is that machines see more than you or I. We as humans are limited usually, to what we have been trained to look for. Machine learning allows computers to explore associations that humans cannot perform. With decent lighting the sex and race detection are actually pretty good!

Sadly, since my datasets are pretty big and using different algorithms for comparison on a semi-old laptop it takes about 20 seconds for the detection to run. I needed a faster method otherwise people who interacted with it would become bored. I found servers online that provide APIs to do the same thing but I needed to sacrifice the freedom to have any of the races I wanted and to create an expanding dataset. Sucks, but it runs in about 2 seconds instead of 20. And it is also good that I have both a version that can run without the internet(original version) and the one with the online API.

Next, the program starts breaking down different features of the face, eye color, hair color, skin color. Color is an interesting thing. On computers the way we define them most frequently is through Red Green Blue(RGB) values. But really what is Red? RGB: 255 0 0? Of course! RGB: 255 100 100? Maybe??? RGB: 255 255 255? Definitely not. even genetic studies reference "blue" eyes, "brown" hair when their blue could include blue green and their brown could also be blackish. So when I was going to associate an SNP with blue eyes, I first needed to figure out what RGB values I thought blue was. That was interesting. I kind of just typed in values and created cut-offs based on what I saw, so pretty arbitrary...

Then I built my database of alleles, that were associated with traits such as race, sex, skin color, &c.

The program also talks to you and shows you videos and your genes.

So from the start:

You walk in and see a large display on the wall with a live feed. It detects your face, it uses machine learning to identify traits about you and tells you about your genome, showing you DNA sequences of the alleles you are predicted to have based on these traits. While it is doing this the program is talking to you generatively by using Google Translate English to English as a text-to-speech engine(little trick I picked up that works GREAT!).

Code for the version using the Online API
https://drive.google.com/folderview?id=0B_R75gIJvkFUczBxNXk3ZGtWRDg&usp=sharing


A bunch of face images cropped, aligned and sorted by self-identified sex (male. female) and self-identified race (caucasian, black, asian)
https://drive.google.com/folderview?id=0B_R75gIJvkFUdVAxNE45NXhSXzA&usp=sharing

 

This video plays when your presence is 

detected in the Scanning Room by the software

What is Art and Science

Lately I have been making the claim that technology revolutions cause changes in culture and those changes are usually integrated into our Art. This is evidenced by Digital Art, Robotic Art and others. Science and Biotechnology are becoming more integrated with our culture and with it brings Science.Art. Sadly, many scientist.artists create pieces that are neither Science or Art. Maybe it is a bit egotistical but I feel a bit shamed to be placed in the same category as these people. The thing is that I never wanted to be placed in the category of Artist. It is not till now when people want to curate my works in museums that I really need to ask myself "Am I an Artist?"

As Kanye said "I ask cause I'm not sure, does anyone make real shit anymore?". Many Science.Art pieces lack either a Scientific part or an Artistic part and to me end up being something that is difficult to appreciate. I often see artists claiming Science but their works are very missleading and are not actually what they say they are or believe them to be. And Scienctists claiming Art when their works are neither. I will give a few as reference.

Christina Agapakis puts bacteria on plates mostly (http://agapakis.com/art.html). This is really not Science. As for it's Artistic merit some could argue for it but this kind of work has been done many many times before in slightly different contexts ala Steve Kurtz and many others. The depth and skill seems lacking and way behind on the times. Maybe it's interesting and speculative nature would have been there 10 or 20 years ago but not now, not like this.

Jalila Essaidi told the world she made "bullet-proof skin". What I thought and imagined was that she trangenically expressed proteins in epidermal cells that allowed them to be bullet-proof. I was interested and I emailed her. What she actually did was take a bullet-proof material and then put human(mammalian?) cells on it and call it skin. (http://jalilaessaidi.com/). She didn't respond to my second email when I asked her the specifics of how the project was done and why she thought it was skin.

Ginger Dosier claims she is an Architect and Scientist. From what it appears, she uses Scientific work others have done and claims it as her own (http://vergelabs.com/). I tried to contact her about her work but she did not respond. It seems the people she impresses don't know enough about biocementation and bioclogging to know better. That is a field I have been starting to work in at NASA. Using engineered bacteria and proteins to harden soils and regoliths. (If you read this Ginger and have performed some new work in biocementation please contact me and let me know what it is. I am sure Scientists would appreciate knowing your advances) 

There are many many more but you get the picture. Maybe people see this as hating, I see it as having a high standard. Having respect for the quality of the work one puts out.


What is Art? People always say that this is a difficult question to answer but I have never thought so. I think that people can argue Artistic Merit of certain works but I think what makes something Art is that it is done by an Artist. Just as Science is done by a Scientist. So who is an Artist? If anything can be Art then what is the need for Artists? Why can't we all just stick petri plates on a wall and be done with it? An Artist to me is someone who is trained and.or dedicated to their craft. Someone who can create works that require "skill" and I think that is the word that differentiates Artists from non-Artists, skill. This is what differentiates a Scientist, a Footballer, a Medical Doctor from everyone else, skill. Skill can be somewhat quantified. If someone claiming to be a Scientist doesn't know Science then they are not. If someone claiming to be an Artist has never been dedicated to the craft then they are not.

I often refrain from calling myself an Artist directly. My work is mostly Science and Engineering with about 10% Art. Lately it has started to travel into the realm of speculative Science and Engineering and that is where the 10% Art comes in.  I think this speculative  but functional nature of some of my works, such as The Chromochord, (What would a future be like when organics are components in electrically engineered projects?) can perhaps be viewed as Artistic. Both the Science and the Art are original.

Look at works of Artists I know, Micah Zayner (https://www.facebook.com/micahjzayner) and Zachary Williams (https://www.facebook.com/pages/Zachary-J-Williams/284392201665097). Their craft is skilled, well thought out and has depth. Just because you go out with your friends and pay $30 to drink wine and paint pictures doesn't make you an Artist or your work a piece of Art. It is some oil or acrylic based colors dried on some material. Art takes dedication and skill.

Scientists can tell the difference between Science and science. Science takes skill, is well thought out and has depth, science does not.


For me Science.Art and Technology.Art require that the Artist add something original to both Science and Art. Maybe these are very stringent requirements and it takes dedication and skill to create a piece of that nature. To me

THAT IS THE POINT OF ART!

Stochastic Labs and The Infinity Engine

I haven't talked much about The Infinity Engine or my residency and grant from Stochastic Labs. In July of 2014 I heard about this mysterious organization known as "Stochastic Labs" that had no website or information about what it was there was just a form to fill out for a grant for ~$20,000. I posted my application on my blog (http://doitourselfscience.blogspot.com/2014/07/stochastic-labs-application.html). They contacted and said that they wanted to fund me, but not me alone, they wanted me to work with someone else and they had this person in mind and her name was Lynn Hershman the director of Strange Culture. Lynn was interested in doing some works around genetic engineering and so was I. I was pretty skeptical at first because I didn't think someone who works in media would have a good idea of how to work on Science projects but I agreed anyway, I mean they were giving me $10k.

I found out Stochastic Labs was in a mansion in Berkeley and it is a nice mansion. Stochastic Labs is funded by The Minerva Foundation. The residency started on August 15th and ended on October 15th. It was short but it was pretty intense. We had dinners there every Monday and gatherings on random days. Alot of cool and interesting people were invited to the Monday dinners. The funny part was I never knew who they were. I would be talking to someone and find out they were an Actor or a Nobel Prize winner or director of a movie I saw.

I would head up to Berkeley after work at NASA and would stay till traffic abated or I ran out of Red Bull around 9 or 10PM and give fellow grantee Greg Leppert a ride home.

Anyways, I had lots of fun up there and worked hard to create a program or "device" I guess which takes a picture of someone and attempts to probabilistically reverse engineer their genome from their physical traits. It also talks to you and tells you what it is doing and what it found. The current iteration is pretty basic it uses facial features to identify ancestry, sex, skin color, eye color, hair color, &c. and maps those to the genes that have been identified to be associated with those traits. Eventually I want it to construct pseudo genomes using an ancestry base genome and editing in traits it identifies from each person it captures.

This will be part of an installation that will be on display starting at ZKM in Karlsruhe Germany on Dec. 12th to the end of March and then will visit other places in the world.

Science Hack Day SF 2014: DIY DNA Sequencing

Science Hack Day San Francisco was this past weekend(Oct. 4th and 5th) and it was a good time. Much better than the Y combinator hackathon I went to a few months ago. The great thing was that most everyone was there to have fun. There wasn't really any competitive spirit and people didn't limit themselves to ideas that were pitches (though it is SF so there were a few of those).

Github HQ is pretty damn nice. Besides the air conditioner being broken it would be great to have it there again.

My hackathon idea was pretty ambitious. The goal was to create a method and protocol for inexpensive, DIY, Sanger DNA sequencing. The goal was _not_ to be able to sequence a whole gene but perhaps just 10-20 basepairs. This would be enough to accurately identify if the DNA you have is your gene of interest.

The problem with normal Sanger sequencing is that it either uses really expensive equipment or uses toxic components, i.e. radioactive primers or nucleobases and acrylamide. What if it was possible to do it without these things?

The goal was to be able to do DNA sequencing with a PCR machine and an agarose gel electrophoresis setup.

Sounds crazy, I know. Sounds very ambitious, I know. But the one thing I have learned over and over again in my life is that if you want to push our boundaries of understanding what is possible one needs to try something crazy and ambitious.

So first the results for people who don't really care about the protocol. I/We were having trouble having the sequencing reactions work so we ended up just attempting to separate two primers that differed by only one base pair. The ability of Sanger sequencing to work depends on if one can separate DNA fragments with base pair resolution.

T7 fwd primer -20 bases
TAATACGACTCACTATAGGG
T7 Terminator - 19 bases
GCTAGTTATTGCTCAGCGG

What one can see in the image in the middle lane is the T7 fwd primer with a fluorescein label and the T7 terminator primer stained with gel green on a 10% agarose gel. The reason I wrote 20.5 instead of 20 is that the fluorescein molecule adds about 0.5-1 base. Still it is amazing resolution. To our knowledge this has never been done before, 1-2 base separation in an agarose gel (imaging was done with a $2 setup, some LEDs and a plastic filter).

I plan to continue this project and successfully run a sequencing reaction to show that not only can we separate with proper resolution we can also sequence.

Information about the experiment is here:
https://docs.google.com/document/d/1d3O254Akps58kaRMoGHL3j47X3bQylEJ2Flbv8UixLc/edit?usp=sharing

A bunch of people helped out:
Nelson Cheung
Cristina Deptula
Petr Glotov
Tito Jankowski
Tim Looney
Michael McCanna(Acrefoot)
Cheryl O'Rourke
Chris Ragsdale
Janelle Ruiz

Motive

I was at the grocery store this morning and saw a child wearing an outfit with wings and I began to contemplate why it was completely acceptable but for an adult it is not really (well at least any place but SF and burning man).

I came to the conclusions that maybe it was motive. A child wearing wings doesn't really have a motive besides to enjoy themselves. An adult when they are wearing wings would have a hard time convincing you that they don't have a motive. Many adults have reached the intellectual place where they can reason about what they wear. This means that choosing what they wear probably involved weighing the consequences and benefits of each outfit. Eventually they can come to the conclusion of "Why the fuck not?" but that is not common as society has shown that people rarely engage in things that are outside of "norm". Probably because we have egos.

Motive comes across pretty well in humans. I was watching videos by tom nestor and my uncle, robb thompson, yesterday (ex. https://www.youtube.com/watch?v=L59a1JPJgWE) . It is obvious in that video that tom is trying to sell you something. His motives immediately seem disingenuous, with the title being "how to quadruple your income"(Why isn't he quadrupling his income? And if he is everyday he should have all the money in the world pretty soon!). Watch his facial expressions, it is obvious he is acting. Motive comes across in your speech especially when giving public talks.

I think this is important as a Scientist or Teacher. People can tell your motives. I used to be really nervous before speaking and sometimes still have a little nerves. It is usually when my motives are different from how I truly feel. Then I have fear of being found out. Most people give talks because they want to impress people. Sure, you can build up a huge ego and that helps overcome the fear of public speaking but so does having a true motive.

Now when I give talks. I give them to tell people about things I am excited and passionate about. Things I enjoy and love. It is hard to be nervous then. People usually want to share in that passion and love. Very very few people responded negatively to love and passion in that situation.

I think about my motives alot. Why do I have blue hair and piercings? Is it because I want them or because I want to portray things to other people? I think it is because that is how I see myself but why do I see myself that way? Maybe I just want to be punk. I think this self-evaluation is always a good thing. It helps me to have genuine motives. Though let's be honest I am not always genuine. But at least I don't look and act like someone such as tom nestor.

Does Hard Work Stifle Innovation?

So yesterday I was at a cookout(which is different from a barbeque in case you did not know) at Stochastic Labs(more about Stochastic Labs soon) and I was tasked with making some fresh squeezed lemon juice for an alcoholic drink. After a few attempts to find or develop a work free method I gave up and just started "hand squeezing" the lemons by using the bottom of a glass as a pommel to press the lemon juice out.

This started an interesting conversation. If labor is free or when it has been inexpensive during times of slavery, did this stifle innovation? It would stem from the "Why develop something new when inexpensive labor will always be plentiful?"

Then this started me thinking about my own life and graduate school and academic Science and Science in general. Does working hard actually lead to more innovation? To the development of new and better things or creative solutions to problems? What if working too hard actually inhibits this process?

It seems to me that there is a point when the pressure to produce something overwhelms the pressure to actually accomplish something interesting or cool or productive. I know during graduate school I worked my ass off and did accomplish some stuff but none of my Scientific body of work would I describe as interesting or cool or innovative. The goals of Science are very insubstantial. Everything is based on the perceived impact of other Scientists and has little to do with the actual outcome of the work.

When is the last time you talked to someone about all of your crazy ideas and they didn't judge you from the outset?

Last night I was chilling at Stochastic Labs and talking with a bunch of well known Scientists and Artists, including Nobel Prize winner Saul Perlmutter who is pretty fucking cool. I never would have guessed. Anyways, the ideas and conversations were interesting and varied but I have never experienced conversations like that in an academic environment. There was no pressure, people's crazy ideas and thoughts were constantly being put out there. Including mine, haha.

I think that graduate school really inhibits genius. The goal in graduate school is not to be a genius. It is to work hard and accomplish something. Maybe that is the problem. Pressure to be viewed successful in the eyes of your peers and mentors anddirect pressure from your peers and mentors does not allow one to actively develop new ideas and try out new avenues of experimentation. Instead of figuring out better methods than a western blot people run hundreds of them. Instead of learning to program you manual input all the data.

If schools truly want to train genuises they need to do that instead of forcing graduate students and post docs to be cheap labor for someone who probably acquired a job as a professor based mostly on good fortune and nepotism.

"I want you to work on your idea." should be a more frequently used phrase in graduate school.
"I want you to take your time." should be said more often.

At least in my life I have learned that a good Scientist.Artist.Technologist needs time to think. Whether it is going for a walk or run or driving around. Maybe it is just sitting and relaxing and thinking. Working isn't the best way to solve a problem, it is thinking and then working.

So I wonder if it is true. Does long work hours and pressure inhibit innovation? Are the best Scientists and graduate students the ones with ample free time?

Evolution of Knowledge

"When Knowledge is Outlawed only Outlaws will have Knowledge."
                                          - Unknown -

We used to say this alot as hackers in the 90s or at least I thought we did. Searching for it now shows <10 results on the g--gle or b-ng. Hmmm. But this kind of goes directly into my point. The Knowledge we are allowed to access is the Knowledge we have. The googs filters your results. They give you the results they or their algorithm(which is they) want you to have. On tw-tter everyone retweets and on faceb--k people have been just posting what everyone else has been posting. Faceb--k now even controls your feed. You don't see everything that happens. You see what they want you to see.

So what is knowledge or information in this age? We are only as creative as the amount of likes on our faceb--k posts and we are only as brilliant as the repetitive media we agree with, the number of tw-tter followers we have and the number of people who like our faceb--k group. Society is being turned into a homogenous population. Holden Caulfield was wrong, people aren't phonies they are just a product of the perpetual regurgitation of things that people tell them.

Where does Knowledge come from now then? How do we find the brilliant pieces among all the chaff online?

Will that be the job of the future, Data Retrieval Expert? I already find it extremely difficult to search for Scientific information online. It is lost in the pile of data. How do we find the Knowledge or data? What happens when the Knowledge, Scientific or otherwise, we have access to is dictated by the search algorithms of places like the googs.

Maybe Knowledge won't be literally outlawed but it will be inaccessible. Is that the same thing?

Access all the Knowledge you can because you are the unfiltered storage device.

This post sounds a little crazy and hopefully a little punk but.... fuck it, I'm not apologizing for it.



 

Mars

Yeah, so ya' know I work at NASA. Space and shit. I will be honest it is pretty cool to work at NASA because we are thinking about the future and not today or tomorrow but 10 years from now or 50 years from now or 100 years from now,(not an oxford comma) and it is pretty cool.

People ask me sometimes if I want to goto Mars. We have a poster on my floor of elon musk that says "I want to die on Mars, just not on impact." it is faux inspirational.

I don't want to die on Mars.

I grew up wanting to be an Astronaut. It is such a self-less life goal. Not only because you are risking your life for knowledge but because you are dedicating your life to something. It is rigorous training.

It's not easy to die, I will be honest. I have read The Death of Ivan Ilych and it destroyed me. Dying is not fun or cool or nice. It is unknown and crazy and hard to deal with. But so is life. Life is harder to deal with than death sometimes.

It is easy to romanticize a trip to Mars while we live our lives doing very little on Earth. I would argue that it is harder to live a life dedicate to an ideal everyday on Earth than to fly to Mars and hope to create an ideal.

It's hard to stay late at work. It is hard to go home and put in extra hours working on projects, coding and developing new ideas. Very Hard. I don't want to die on Mars I want to die on Earth. I want to die exhausted and tired from working so hard to explore a cool future that I can only imagine in my mind. Hopefully, I can make some parts of it reality. Maybe not. It is hard work. It is hard to work 10 hours then come home, eat dinner and work 5 more. It is hard to dedicate life to a singular purpose that is greater than yourself.

Most people don't have the benefit of working at NASA, which makes it even harder. I was there one time also. Working the night shift at UPS loading packages on trucks so I could have money to goto school so I could imagine. Imagine a better life. A life where people don't suffer. A life where I am and other people are in awe of what goes on around them. That shit is not easy. It's not easy to have a vast array of knowledge or work on projects no one cares about or is paying you for. It is not easy to dedicate one's life to something that doesn't involve Social Media or clicking on ads or hopes of lots of money.

It's a simple question. If you had $Billions what would you buy? Would it be a house and a nice car? Something for your Mom? Great, I love my Ma (That's how we say it) also. But first, the first thing I would do is use that money to create something more than myself.

I am 33 and have been training to be a Scientist for over 10 years. A computer programmer for 15-20. And my contributions still pale in comparison to what is possible.

Ya' know what I want to do? I want to live.  Maybe just for another day. But tomorrow I am going to try hard. And the next day. And the next. Maybe not as hard as I could have tried but I am going to try hard.

Don't live to die. Accept death because of how you lived.

(Inspired by a Dream I had)

Y Combinator Hackathon

I was pretty excited about the Y Combinator hackathon. I really enjoy hackathons because you can just throw on your headphones and hack and not worry about anything. They serve you food and energy drinks and coffee and whatever you need.

It was an interesting hackathon because one had to apply and be accepted to be able to attend. I originally applied as a joke when I was drunk one night looking for hackathons in the Bay Area. I totally forgot about it until I received an email that said I was accepted and decided why not go? Free food and stuff. I later found out that this thing was kind of important and people attended from all over the world. Winners or top three or something receive a Y Combinator interview. If you don't know what Y Combinator is http://en.wikipedia.org/wiki/Y_Combinator_(company)

It was a funny hackathon because I knew a month in advance or so. I planned out my hack but could have just done it at home (what I ended up doing but more on that later). The only rule was that you could not create code before the hackathon started but you could use Open Source code. What is the coolest Open Source code? DNA. I figured I would make something that utilized some genetic engineering.

My goal for the hackathon was simple enough to create something like this: https://www.youtube.com/watch?v=tUFscEVK5Ks except automate it so someone can turn it on and off with a switch or it would turn on automatically when light became low. The funny thing is that there was more prep work then actual work. I guess I did not anticipate it being so simple and working out so easy.

Prep Work

I acquired some pJE202 plasmid and transformed it into DH10B and BL21 E. coli cells. Both the lifetime of bioluminescence and brightness on plates was markedly different. BL21 was much brighter and lasts much longer. As it should, BL21 is a protein expression strain and deficient in some proteases.

Next, I tested different medias. Initially I did not see any bioluminescence as I was using SOC, SOB and the likes. However, it worked fine in LB. Growing at RT gives it some nice glow. Interestingly, if the temperature ever reaches above ~30C the bacteria stop luminescing (My apartment sometimes warms up during the day!). I read some stuff online about how people tried glycerol and CaCl3 and that increased the light output. CaCl3 definitely decreased it but glycerol increased it slightly. However, Sucrose.Glucose addition worked best. Both visually and quantitatively (measuring luminescence using a plate reader).

I started up cultures on Friday morning and Friday night for the hackathon on Saturday.

Hackathon

Registration started at 10AM but the hackathon did not start till 12PM. I ate a bagel and talked to the Pebble watch people. They were selling watches for $75 and I was thinking of buying one but the watches do absolutely _nothing_. I was mostly intrigued that the API was in C. They connect to your phone, sure, but they have 1990 cellphone menus, 4 buttons and an accelerometer. and the accelerometer was the best part. Unfortunately, I can build things with an accelerometer myself so the device was kind of pointless to me. If it actually had an operating system it might have been cool.

Sidenote
The world is moving towards small portable devices, whether you like it or not. Not many people still have desktop computers(I have two) but as the devices are slimmed down and capacity and speed increases. It seems inevitable that whole operating system are going to be written in things that are web compatible. Everything is written in Java(script), Python and such and I think that is only going to become more pronounced. Which unfortunately means I probably need to invest sometime to learn these languages better. I can functionally code in them but not anything complicated.

Y Combinator has two buildings and I was told that all hardware people should goto the extension building across the street and not the main building. As far as I could tell I was one of or the only person physically hacking hardware. Everyone was about 18 years old or younger. Some of these people had to be under 16 years of age. That's not an issue I guess but the hackathon ideas were soooo how does one say??? Immature? I guess my idea wasn't the best. A lamp that can be turned on and off but illuminates by bioluminescent bacteria?

Here are some of the ideas people had from the YCHacks facebook page:
A Start-Up Founder Support Network for Depressed Start-Up Founders
Transforming The Retail Boutique Space
A web application where people can post stories and receive upvotes from the community where each upvote is a bitcoin tip
One centralized place to keep track of all the places you have your addresses/credit cards stored.
A calendar app that negotiates meeting times with other people automatically


I knew this was not my scene from seeing these ideas. People say things like "Front-End Developer" and "Back-End Developer" and I don't even know what these things mean. Seriously. Well I just looked them up and they mean "programmer", hahaha. Some guy at the hackathon asked me if I did "Front-End" and I didn't know. Now I know. Yes, I do "Front-End" and "Back-End" and Side-End. Are there seriously people who do "Front-End" and don't know how to do "Back-End" so that the two need to be separated?

There were no chairs.
Y Combinator has picnic benches and they were filling up fast, people brought fucking giant computer monitors.... I am talking 28 inch. I found a spot but the window was directly behind me and the California sun was producing some brutal glare on my laptop so I decided to go sit on the floor somewhere. At least then I could lean back against the wall. I am more of a sloucher then a huncher when I spend all day at my puter so it was better any way.

So I busted out all my stuff on the floor and started hacking. Trying to work with a solderless breadboard and electronic components and an Arduino and a laptop is pretty annoying on a floor. Not to mention a group 7 or 8 people decided to congregate next to me so that no one could pass by without stepping.tripping over me and my stuff. There was plenty of other places to stand, just the typical California unawareness of surroundings. My goal was just to use an Arduino to control a pump through a MOSFET and use a light sensitive resistor to activate it all. The way the night light or lamp would work is that when the light in your house or apartment decreased it would activate the pump and start giving the culture oxygen which would cause it to luminescence.

They didn't have red bull. Fortunately, I predicted this and brought my own red bull hah. Everyone was drinking coca cola for caffeine.

It was loud. Did I mention it was loud. At ~3PM, 3 hours after starting no one was really working people were talking. I had my headphones in but still the background decibels was _loud_. You know the coding zone? When you throw on some chillstep or trance or whatever music you like and just work. I just couldn't do it. It was that loud. I was seriously starting to be really annoyed. It was hard to focus and concentrate. I am not a big extroverted person even though some people would think otherwise. I like to be holed up alone and in a quiet environment. I am sensitive to noise and light. If there is a faucet dripping in the other room it freaks me out. So yeah, I was not enjoying myself.

The internet was slow. I guess that is what happens when your network was not prepared for a couple hundred people to use it. Finding the technical documents for the MOSFETs I had, took forever, because they were all 900KB PDFs, hahaha.

Then a group of guys sat down next to me and started to play music on one of their laptops. I also about finished up the hardware part of my hack and need to test it on the actual cultures. I didn't bring them with because they are temperature sensitive and such.

I was not enjoying myself. Other people seemed to be enjoying themselves just fine it just was not the ideal environment for me to hack. It's weird because I would imagine most "hackers" are like myself. But I guess they come in different types. Maybe the introverted, loner stereotype is not true anymore?

So I decided to go home. I figured I could have my own "hack day" at home and would enjoy myself much more and I had more red bull at home.

I appreciate the opportunity to goto the hackathon. It was not my thing. I don't know if I would try it again. I goto hackathons for fun. I am not trying to start a company or find investors. I just want to make something kind of cool.

I hacked till about 11PM. I fixed and finished up my KGloves so the mouse function works. Now they control a keyboard and mouse really well. I also finished up my Y Combinator hack.

Here is a video of it. Sadly, my camera was not working well in the dim light. The glow is actually fairly bright and looks super cool. Sadly, most of my cultures warmed up overnight and now are not glowing much anymore! I will try and grow up and new batch and see if I can make a better video. But for now check this out, when I turn off the light it activates the sensor and the pump, which feeds oxygen to the bacteria and they glow.

https://www.youtube.com/watch?v=wUuukaE13cY

What would you talk about?

So you have an audience of any size, 1 person, 10 people, 1 billion people and they are planning on listening to you or attempting to listen to you, for however long you plan on talking. What would you talk about?

Sometimes I like to knock people like Bill Nye for not being a Scientist(http://en.wikipedia.org/wiki/Bill_Nye) but he has something to talk about. Mostly, palatable Science for the public. And that is all he talks about. He knows how to work it. I think this is an interesting characteristic of many public figures, find something to talk about and then talk about it, alot.

Anyways, this post was originally intended because SXSW submission for talks is due July 25th and I have not decided on what I would propose. I do lots of things and I have lots of angles so it is hard to choose and figure out what people would be most interested in hearing about.

It also needs to have substance. I mean sure people need to be entertained. I understand that. But I don't think I have ever listened to something like a TED talk and learned anything from it. I guess that is somewhat the opposite end of the spectrum though as they are mostly substanceless.

Last year when I was at SXSW I was disappointed in the fact that most of the talks I went to were neither entertaining or had any substance(I'll be honest I only went to like 5). One of the exceptions was a talk by Ernie Cline(http://en.wikipedia.org/wiki/Ernest_Cline). I am sure there were others.

What kind of substance do people want? Though people think it is incredible to pretend like they are interested in a quantum mechanics lecture, they obviously have never sat through one. Yay, let's go over the derivation of the Schrodinger equation and then apply it to the Hydrogen atom. Too much substance.

Do people even want substance? Maybe I do but I don't know if my views are generally aligned with others in the human population.

I have really been involved in genetic engineering bacteria for useful or fun things in my job or on the side and I want to talk about that in some way. I also do lots of DIY.Maker.Hacker.whatever you want to call it stuff. I wonder how I can give a new perspective on things such as that?

I don't know what to talk about.

And I should.

Stochastic Labs Application

This place in the Bay Area Stochastic Labs(not much information on them) was asking for applications to give $20k to Science, Art, Technology projects. I heard about it with about 24 hours before it was due but decided to write something up because I thought it would be a good exercise and a good way to put some of my thoughts down.

Here it is in all it's glory:


Bio (500 words)

My name is Dr. Josiah Zayner (really Dr.? yeah I know seems pretentious sorry) and I work as a research Scientist at NASA attempting to develop biotechnology for long-term space exploration and colonization. I started in on science and technology in my late teens. At the age of 19 I received a job with Motorola as a Network Engineer and Programmer for their iDEN cell phone network. In the early 2000s I was laid off when the tech bubble burst and I decided to goto college. I ended up with a B.A. in Plant Biology from Southern Illinois University and an M.S. in Cell and Molecular Biology from Appalachian State. For my Ph.D. I studied how light activated proteins function and how to develop them as optogenetic tools. I received my Ph.D. from the Department of Biochemistry and Molecular Biophysics at the University of Chicago in 2013 where I won the Best Thesis Award. I am currently(Till Dec. 2014) an Imagine Science Artist in Residence and a self-taught computer.microcontroller programmer and electrical engineer. I even wrote a slightly useful piece of software for firewall testing and network troubleshooting called IP Sorcery. Definitely, my claim to fame… No, no it was biotech’s first musical instrument, the Chromochord (http://www.scientificamerican.com/article/biotechs-first-musical-instrument-plays-proteins-like-piano-keys-slideshow/). Or even The ILIAD project (http://www.npr.org/blogs/health/2013/12/04/248854769/scientists-turn-to-the-crowd-in-quest-for-new-antibiotics?ft=1&f=1001). or maybe The Kglove?(http://doitourselfscience.blogspot.com/2014/05/the-kglove.html)

What project are you most known for?(500 words)

If I had to choose a single project that I am most well known for it would probably be The Chromochord. The Chromochord is a musical instrument that allows the musician to strum proteins quantum mechanically like they would strum a guitar. The basis of the instrument is s type of protein called Light-Oxygen-Voltage ((LOV) Pronounced Love) domains. These proteins respond to light by undergoing a quantum mechanical energy transition(from a singlet to triplet state) that changes their photo absorption properties. This can be measured spectroscopically. Once in this triplet state this “vibration” decays over time due somewhat to thermal energy. It is very analogous to strumming a guitar string and the kinetics can probably be modeled very similarly. The measured values from these fluctuations in excitation and decay can be used digitally to modulate MIDI notes on a computer. It basically works by the musician interacting with the protein using light by activating LEDs, the excitation of the protein is measured spectroscopically as it is excited or decays and then the computer sonifies this into whatever sound the musician wishes. For The Chromochord I wrote the software and built the hardware and synthetically created and purified the proteins. I have given a number of concerts, talks and demonstrations on The Chromochord.

More Information and media on The Chromochord can be found:

http://www.scientificamerican.com/article/biotechs-first-musical-instrument-plays-proteins-like-piano-keys-slideshow/

http://www.theverge.com/2013/9/5/4694324/biophysicist-uses-proteins-to-create-chromochord

http://en.wikipedia.org/wiki/Chromochord

https://www.youtube.com/watch?v=LJoFazIJ3w4

https://www.youtube.com/watch?v=jlp-k8tqVl0

What project are you most proud of?(500 words)

The project that I am most proud if would probably not be the conventional definition of a “project”. It is my Ph.D. Thesis. I remember the first journal article I wrote that my thesis would stem from (https://drive.google.com/file/d/0B_R75gIJvkFUeVAzZWxsRjJ3R28/edit?usp=sharing). I poured my heart into that article. All the beauty and pain and Science that was me at that point in time is in that article. The figures of the publication were painstakingly crafted to try and portray how much this work meant to me. My Science had become Art and I just wanted others to recognize that. Unfortunately, Science is a very critical and ego driven world. My paper suffered many blows by people who knew little about the Science behind the work. My life changed after that. Science to me was no longer about publishing in well respected journals or being famous or receiving a prestigious professorship and instead became about the beauty in the experiment. My Thesis work became about beauty and creativity, seeing and creating something that I was proud of and something that was beautiful regardless of what others thought of it. My Thesis is the most personal and insightful document into me and my life except instead of a narrative the descriptions are my experiments. Very few people will ever be able to read it and understand me that way because the key to unlock that insight is knowledge and knowledge is not something that can be bought.

My thesis can be found here: https://drive.google.com/file/d/0B_R75gIJvkFUWVAxNWVNTFRmX0E/edit?usp=sharing

Tell Us about your project(1000 Words)

The project I have been working to create is the first living rewritable hard drive. Using light activated gene expression of fluorescent proteins in engineered bacteria I plan to create a computer interface that allows the writing of data to wells of bacteria. The system will be comprised of three major parts: 1) Engineered DNA and Bacteria 2) Camera and Lighting System for Fluorescent Imaging 2) A Computer to Record Data and Interact with the Bacteria.

The Bacterial system will be composed of two plasmids: one will contain a blue light activated gene expression system that creates the Red Fluorescent Protein(RFP) that can be imaged, with a degradation tag, the other plasmid is a green light activated gene expression system that expresses the ClpA, ClpP and ClpX proteins that will degrade the RFP due to the degradation tag. The bacteria will be placed in a 384 well plate, 1 bit per well. When the bacteria express the RFP it will accumulate and will denote a 1. When there is no RFP or the RFP falls below a certain level due to degradation the value will be a 0. This allows 48 bytes of information storage. The camera, lighting and filter system will image the plate for processing on the computer. The computer will read the values and reconstruct the data just as if the data was stored on a hard drive or other media.

By exposing a well to blue light, the bacteria will be “written to” by expressing the RFP protein that can be imaged. By exposing a well to green light, the bacteria will be “erased” as the RFP is degraded.

The blue light system has been mostly created into a plasmid by Ohlendorf et al., only the tag needs to be added to the RFP. All the DNA sequences and primers have been designed and only need to ordered. The parts that need to be accomplished are: the ClpA and ClpX proteins need to deleted out of the bacterial genome, the green light system DNA needs to be ordered and cloned into a plasmid. The hardware and software need to be created. Because the lighting hardware will be very similar to The Chromochord I will base it off that, which should significantly ease the developmental process.

All Engineered Bacteria, Plasmids and DNA will be made available Open and Free to the community of biohackers and anyone else who wants them. All software and hardware schematics created will also be made Open and Free so others can create their own systems.

References

Ohlendorf et al. (2012) From Dusk till Dawn: One-Plasmid Systems forLight-Regulated Gene Expression

https://drive.google.com/file/d/0B_R75gIJvkFUaTVNN0NhVnFTN2s/edit?usp=sharing

Farrell et al. (2005) Cytoplasmic degradation of ssrA-tagged proteins

https://drive.google.com/file/d/0B_R75gIJvkFUUVNuNEpwZEk5M3M/edit?usp=sharing

How is your project Innovative(500 Words)

There has been very limited work done on biological rewritable systems. A publication by Jerome Bonnet in 2012 attempted to use recombination to create a rewritable system in bacteria. However, it suffered from from two major problems: 1) It is extremely noisy and requires precise tuning to achieve the rewritable nature of the system 2) It requires the addition of chemicals to switch the state of the system. This makes the system unusable as a living hard drive. As far as I know, there has not been any other work that attempts biological storing of information and rewriting.

Other working attempts to use DNA to store information is not a viable rewriting solution as we do not know how to manipulate DNA on the level of writing and rewriting yet in a living cell.

How does one define Innovative? Because some people think Yo is Innovative (http://valleywag.gawker.com/the-man-who-gave-yo-200-000-1593328826). I would rather describe this project as unique, interesting, inspiring and perhaps a little beautiful. No one has ever created something like this. People will be able to visualize the inner workings of the device and interact with it by writing to the living drive. Whatever people want to call it, I just think it is damn cool.

References

Bonnet et al. (2012) Rewritable digital data storage in live cells via engineered control of recombination directionality https://drive.google.com/file/d/0B_R75gIJvkFUM21KR1FRVnFmbk0/edit?usp=sharing

How do you plan to reach.build your audience or user base(500 words)

I plan to reach my audience and user base using many different mediums. I write actively for my personal blog about Science, Technology and Art (http://doitourselfscience.blogspot.com/) and would document the process. I am a member and teach classes at Biocurious in Sunnyvale and would do project demonstrations there. I am also an Artist in Residence for Imagine Science films, they would help me document and publicize the work once it is completed. I also currently run the only DIY Science online store(http://www.the-odin.com). The plasmids and bacteria will be available for free on the store from funding provided. I am heavily involved in the DIY Science and Art community online and could find opportunities through people I know to present this work in Chicago and New York city besides the Bay Area.

How do you plan to use the 20k grant(500 words)

https://docs.google.com/spreadsheets/d/19uG123bXLtnWZx9XBIl-dBqxOpGelS_SmYp8LC4RNvo/edit#gid=0

Item
   

Cost
   

Description

Travel
   

$300
   

2 Months Caltrain Pass and.or Gas to Berkeley

Genes and Primers
   

$3,000
   

DNA synthesis will be ordered from IDT

Reagents and Enzymes
   

$2,000
   

For, PCR, Gibson Cloning, Ligation, Restriction Digests

Computer Controlled Camera and accesories
   

$800
   

GoPro HERO3+ or Similar for Fluorescence Imaging

Light Filters
   

$300
   

Light Filters for Fluorescent Imaging

Hardware
   

$400
   

Microcontrollers, LEDs, Misc. Components

Laptop Computer for Art Installation and Other Displays
   

$1,100
   

Inspiron 15(for running Linux) ~$900 + Tax and Shipping

Living Expenses
   

$500
   

Food and Red Bull for Working Late Nights and Alcohol for trying to sleep after those late nights

Plasmid and Bacteria Distribution
   

$300
   

This would provide enough plasmid and bacteria to distribute it free to ~1000 people

Miscellaneous and Unforeseen Expenses
   

$1,300
Basic Molecular Biology Class
   

$1,000
Supplies to teach 3 free basic molecular biology classes

   

   

Total
$11,000
   


What are the greatest challenges to success(500 words)

The project is theoretically sound but still theoretical. The greatest challenges will definitely be in the DNA engineering because the green light system has not been tested yet in living bacteria. If the green light system works, I predict the chances of success being in the 75% or greater range. Even if the green light system does not work a “punch card” like memory storage design could be created from only the blue light system and plates, i.e. only writable once. The hardware and software required is fairly straightforward and will just require some time to sit down and write it.

How do you think your project will benefit from STOCHASTIC community(500 words)

As a Scientist I have not had the chance to develop many of the skills that surround presenting Art. Honestly, I would not know how to even begin to find a place to hold an Art installation or even how to hold one(I guess I could always search the internet). Further, because I enjoy the Science and Engineering part of projects some of them are less than aesthetically pleasing and use copious amounts of duct tape. I think that being around other Artist’s could help me out alot in the many aspects of Art that I have not experienced being primarily a Scientist and Engineer. FInally, groups of intelligent and creativity people often can give you an objective perspective of your work that cannot be reached otherwise.

Rough timeline

Money being deposited in my account being the start of Week 1

Week 1 will be the ordering of DNA and components.

Depending on when DNA arrives(1 - 2 weeks)

Weeks 1,2-4 to clone green light activated system

Weeks 1,2-4 to remove the ClpX and ClpA genes from bacteria

Weeks 4-8 to create hardware and software system

Obvious, this is an accelerated timeline and there are chances that this will likely take 3-4 months to complete.

What building event or service project do you plan to do

I plan to teach 3 Free Molecular Biology classes at either Biocurious, Counter Culture Labs or Berkeley Biolabs(or all three). The class will teach people how to amplify and clone synthetic DNA fragments into bacteria to create a unique organism.

Anything else

I just found out about this grant at ~10PM on July 2nd or the application would be of much higher quality and would not have been submitted so last minute. I thought this would be a great opportunity to work on a dream project I do not currently have the monies to fund.

Links to content

Designed Primers, Genes and DNA sequences for the project:
https://docs.google.com/document/d/1J8bKYXBEL6PBVcbqY5BSJE39OyL147cl_WGgtyidkuo/edit?usp=sharing

Link to answers in one file:
https://docs.google.com/document/d/1d9DqUobiqNxoqzDKEszqrJZQDAa0MDGotcy_Q3uEVIM/edit?usp=sharing

My blog:
http://doitourselfscience.blogspot.com/

Who is a Scientist?

i don't know.


To most people I would guess that this seems like a simple question and they would answer "A Scientist is of course, someone who went to graduate school and performs Science as a job." Yeah, sometimes I want to take that stance also. The problem is that I know that it is probably not true.

I grew up in the 90s and early 2000s computer hacking scene(I know I always say this) and if someone were to ask, "What is a computer programmer.developer?" I would have probably answered "Someone who programs in a complex programming language and has written a program or been involved in a project that consisted of thousands of lines of codes." What that means is that everyone can be a developer if they know how to code and do code. That was me. Of course there were lots of things I missed in programming because I never went to school for it and suffer for it now in my coding(why I always encourage people who are really excited about Science to goto Graduate School). Still I could hang with the best of them evidenced by Motorola hiring me. Someone writing a chapter in a book about a program I wrote. &c.

Is this a good analogy for a Scientist though?
One can program without knowing much math or even about how a computer works. It is almost self-contained. Science is NOT! One problem I run into alot with non-trained DIY Science Enthusiasts is that they lack some of the basic knowledge and skills that would allow them to do significant experiments. Sure, I understand DIY Enthusiasts are not all out to do significant experiments. I also understand that I can change this by providing people with knowledge and tutorials on how to do Science and I do (http://www.the-odin.com/tutorials/) Yeah, so this issue can be overcome. (No thanks, to the DIY zine Biocoder who rejected my tutorial on computational protein science? I know, it's my fault, I suck at writing).

So what's the problem? Why does it matter?

I think it matters because the people who are providing Scientific knowledge and training to others, sometimes as mass media, do not have the proper knowledge and skills to evaluate what is good Science and what is not. They sometimes don't even know Science well enough to understand that the statements they make are unScientific. Did you know Bill Nye was never a Scientist or trained as one? He has a Bachelor's Degree in Engineering. That's it. And somehow this man has become the voice for the Scientific world on things like Global Warming... But I am sure he has studied the data thoroughly........... for years....

This is a huge example, so imagine how bad it is as you go down the ladder. People who are considered leaders in the DIY Biology community know little to nothing about actual Science or what is possible (No we can't stick a Monkey's head on a human body, sorry). And they pretend like they can "train" people. And it doesn't seem like trained Scientists really want to be involved. Why not? I guess they don't see the advantage? And they think that DIY Scientists can't really do much (which is kind of true at the moment).

To me I want to be inclusive. Sometimes I want to say, someone who is excited about Science and performs experiments is a Scientist (which is more than I can say for many Graduate Students and Post Docs ROFLMao......) And maybe that is the answer. But because "Scientist" is a title, it denotes some exclusivity. Someone who enjoys playing basketball is not considered a "Basketball Player". Just as someone who transformed bacteria with GFP once is not a Synthetic Biologist...

It is a fight between logic and ego and all those random Science pictures that go around the internet that try and convince people that something amazing is going to come by using a Drosophila eye as a model for the human belly button.

Just because you read Harrison's Principles of Internal Medicine doesn't make you a Medical Doctor(in fact if you called yourself one you could probably be taken to jail?). But anyone who has a slight interest in Science can be considered it's voice...

I am still at the same place where I began.

Who is Scientist?


i don't know. are you one?

The KGlove

Lately, I have been coveting lots of cool tech toys, Google Glass and Oculus Rift. I decided I wanted some wearable computing of my own and so like any decent Hacker I decided to build a wearable computer and interface myself.

Before Jumping into the Optical setup I wanted to make sure I had a keyboardless way to type on a computer. Though speech to text is awesome I don't want to be in a bar or room of talking people and not be able to type. So I decided to build the KGlove. Basically, the KGlove is an input interface to a computer that is activated when you bend your fingers. It uses an Arduino and flex sensors. I am going to make it wireless and add in an accelerometer soon for the mouse. I made it so I can type characters using it and also play MIDI, like playing a piano without a piano, see the end of the video.

The way the text typing works is that each finger on the right hand represents a character in alphabetical order and each finger on the left hand goes to the next set of 5 letters.

So Right Thumb is 'a' and Right Index Finger is 'b'.
If I do Left Thumb and Right Thumb that is 'f', the sixth letter or Left Thumb and Right Index that is 'g'. Having the letters in order makes it really easy to learn. This only leaves me with 30 possible characters. However, by combining Left Finger combinations I should be able to achieve 3125 different possible characters(key presses). The hardest part is muscle control. Bend your middle finger, your ring finger wants to bend also. So controlling that movement and calibrating the sensors is important.

Code is all available Here

I am just learning to type with it so in the video sometimes it takes me a second to remember which finger combination is which letter. Also, sometimes I need to backspace. Yeah, I made sure I had backspace, haha.
Oh yeah at the end you can tell I am not a musician or pianist. hahaha.